Pathology: schwannoma

Circumscribed; cellular

Spindle cells with loose fascicular pattern

Eosinophilic cytoplasm

Ovoid hyperchromatic nuclei with mild atypia and occasional pseudonuclear inclusions; inconspicuous mitotic activity 

Vessels with hyalinized walls 

IHC: S100, SOX10

DNA-Seq: NF2 mutation (c.790_810+17delATCTCGTACAGTGACAAGGAGGTAGGACATGTGTGTAC; p.Ile264_Glu270del)

Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with loose fascicular and microcystic pattern

Eosinophilic cytoplasm 

Ovoid hyperchromatic nuclei with mild atypia and occasional palisading; inconspicuous mitotic activity

Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with loose fascicular pattern

Eosinophilic cytoplasm

Ovoid hyperchromatic nuclei with mild atypia and occasional palisading; inconspicuous mitotic activity 

Ectatic blood vessels with hyalinized walls 

IHC: S100, SOX10, INI1

Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with loose fascicular pattern

Eosinophilic cytoplasm 

Ovoid hyperchromatic nuclei with mild atypia; inconspicuous mitotic activity

Ectatic vessels with hyalinized walls

IHC: S100

Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with loose fascicular pattern

Eosinophilic cytoplasm 

Ovoid hyperchromatic nuclei with mild atypia; inconspicuous mitotic activity

Vessels with hyalinized walls

IHC: S100

Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with loose fascicular pattern

Eosinophilic cytoplasm 

Ovoid hyperchromatic nuclei with mild atypia; inconspicuous mitotic activity

Ectatic vessels with hyalinized walls

IHC: S100

Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle-epithelioid cells with loose fascicular and rosette-like patterns

Eosinophilic cytoplasm 

Ovoid hyperchromatic nuclei with mild atypia; inconspicuous mitotic activity

Dystrophic calcification

IHC: S100, SOX10, epithelial membrane antigen

PMID: 10193326

Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with loose fascicular and microcystic pattern

Eosinophilic cytoplasm 

Ovoid hyperchromatic nuclei with mild atypia and occasional palisading; inconspicuous mitotic activity

IHC: S100, SOX10

Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with loose fascicular and microcystic pattern

Eosinophilic cytoplasm 

Ovoid hyperchromatic nuclei with mild atypia and occasional palisading; inconspicuous mitotic activity

IHC: S100, SOX10

Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with loose fascicular and microcystic pattern

Eosinophilic cytoplasm 

Ovoid hyperchromatic nuclei with mild atypia and occasional palisading; inconspicuous mitotic activity

IHC: S100, SOX10

Circumscribed; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with loose fascicular pattern

Eosinophilic cytoplasm 

Ovoid hyperchromatic nuclei with mild atypia; inconspicuous mitotic activity

Occasional small hyalinized vessels

IHC: S100, SOX10

Lobulated with peripheral lymphocytic cuff

Spindle cells with vague fascicular pattern

Eosinophilic cytoplasm 

Ovoid nuclei with small nucleoli and mild atypia; rare mitotic activity

Inconspicuous vasculature 

IHC: S100, SOX10

PMID: 2400975

Lobulated; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with fascicular pattern

Eosinophilic cytoplasm 

Ovoid monomorphic nuclei with inconspicuous mitotic activity

IHC: S100, SOX10

DNA-Seq: NF2 mutation (c.169C>T; p.Arg57*)

Ill-defined margin; areas of hyper- ("Antoni A") and hypo- ("Antoni B") cellularity

Spindle cells with nodular pattern

Eosinophilic cytoplasm 

Ovoid monomorphic nuclei with inconspicuous mitotic activity

IHC: S100

PMID: 9568513