Pathology: gastrointestinal stromal tumour

Gastrointestinal stromal tumour, spindle cell (multifocal)

• Spindle cells in vague fascicles

• Pale amphophilic cytoplasm with long tapering processes 

• Monomorphic spindle-ovoid nuclei; inconspicuous mitotic activity 

• DNA-seq: KIT exon 11 mutation (c.1727_1728delTTinsCA; p.Lys576Pro)

• NB: a second, vascular, GIST: KIT exon 11 mutation (c.1676T>A; p.Val559Asp*)

Gastrointestinal stromal tumour, spindle cell

History of NF1

• Spindle cells in vague fascicles

• Pale amphophilic cytoplasm with long tapering processes 

• Monomorphic spindle-ovoid nuclei; inconspicuous mitotic activity 

• Neuronal hyperplasia

• IHC: CD117, DOG1, S100, SOX10

Gastrointestinal stromal tumour, spindle cell

• Spindle cells in vague fascicles

• Pale amphophilic cytoplasm with long tapering processes 

• Monomorphic spindle-ovoid nuclei; inconspicuous mitotic activity 

• Focal mucosal ulceration

• IHC: H-caldesmon, CD34, CD117, DOG1

• DNA-seq: KIT exon 11 mutation (c.1679T>A; p.Val560Asp)

Gastrointestinal stromal tumour, spindle cell

• Lobulated; spindle cell fascicles

• Pale amphophilic cytoplasm with long tapering processes

• Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity 

• IHC: CD34, CD117, DOG1

• DNA-seq: KIT exon 11 mutation (c.1661_1705delAAGTACAGTGGAAGG; p.Glu554_Tyr586del)

Gastrointestinal stromal tumour, spindle cell

• Lobulated; spindle cell fascicles

• Pale amphophilic cytoplasm with long tapering processes

• Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity 

• IHC: CD117, DOG1

• DNA-seq: KIT exon 11 mutation (c.1691_1726delATGGAAACAATTATGTTTACATAGAC)

Gastrointestinal stromal tumour, spindle cell

• Lobulated; spindle cell fascicles

• Pale amphophilic cytoplasm with long tapering processes and occasional perinuclear vacuoles

• Ovoid and elongated nuclei with minimal pleomorphism; conspicuous mitotic activity 

• Mucosal ulceration; focal myxoid stroma; patchy necrosis

• IHC: H-caldesmon, keratin (AE1/AE3)* 

• DNA-seq: KIT exon 11 mutation (c.1673_1674insTCC; p.Lys558delinsAsnPro)

• PMID: 18715619

Gastrointestinal stromal tumour, spindle cell

• Lobulated; loose spindle cell fascicles

• Eosinophilic cytoplasm with fibrillary processes and occasional perinuclear vacuoles

• Ovoid and elongated nuclei with hint of palisading and minimal pleomorphism; inconspicuous mitotic activity 

• Attenuated mucosa

• IHC: CD117

• DNA-seq: KIT exon 9 mutation (c.1504_1509dupGCCTAT; p.Ala502_Tyr503dup)

Gastrointestinal stromal tumour, spindle-epithelioid cell

• Lobulated; spindle-ovoid cell fascicles

• Eosinophilic cytoplasm with fibrillary processes and occasional perinuclear vacuoles

• Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity 

• Focal oedema

• IHC: CD34, smooth muscle actin, CD117, DOG1

• DNA-seq:  KIT exon 9 mutation (c.1504_1509dup; p.Ala502_Tyr503dup)

Gastrointestinal stromal tumour, spindle cell

• Lobulated; spindle-ovoid cell fascicles

• Eosinophilic cytoplasm with fibrillary processes and occasional perinuclear vacuoles

• Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity 

• IHC: CD117 

• DNA-seq:  KIT exon 9 mutation (c.1504_1509dup; p.Ala502_Tyr503dup)

Gastrointestinal stromal tumour, spindle-epithelioid cell

• Lobulated; spindle-ovoid cell fascicles

• Granular amphophilic cytoplasm with fibrillary processes 

• Round-ovoid nuclei with prominent nucleoli and mild pleomorphism; occasional mitotic activity 

• Mucosal ulceration; chronic inflammatory infiltrate

• IHC: CD34, CD117, DOG1

• DNA-seq:  KIT exon 13 mutation (c.1924A>G; p.Lys642Glu)

Gastrointestinal stromal tumour, epithelioid cell, SDHB-deficient

• Lobulated; epithelioid cells with nested-pseudoacinar pattern

• Granular eosinophilic cytoplasm

• Round-ovoid nuclei with prominent nucleoli and minimal pleomorphism; inconspicuous mitotic activity 

• Focal necrosis; prominent capillary-sized vasculature

• IHC: CD34, CD117, DOG1, SDHB

• DNA-seq: negative

Gastrointestinal stromal tumour, epithelioid cell

• Infiltrative; sheets of epithelioid cells

• Glassy amphophilic cytoplasm

• Ovoid nuclei with mild pleomorphism; inconspicuous mitotic activity 

• Interspersed mesenteric adipose tissue with a 'honeycomb' pattern

• IHC: CD117, DOG1, SDHA, SDHB

• DNA-seq: wild-type

Gastrointestinal stromal tumour, dedifferentiated

• Spindle cells in vague fascicles

• Pale amphophilic cytoplasm with fibrillary processes 

• Ovoid nuclei with marked pleomorphism and frequent multinucleation; conspicuous mitotic activity 

• Mucosal ulceration; focal myxoid stroma; patchy necrosis

• IHC: CD34, CD117, DOG1

• DNA-seq: KIT exon 11 mutation (c.1679T>A; p.Val560Asp)

Gastrointestinal stromal tumour, spindle-epithelioid cell

• Spindle-epithelioid cells in vague fascicles

• Pale amphophilic cytoplasm with fibrillary processes 

• Monomorphic ovoid nuclei with small nucleoli; inconspicuous mitotic activity 

• IHC: CD34, CD117, DOG1

• DNA-seq: PDGFRA exon 18 mutation (c.2525A>T; p.Asp842Val)

Gastrointestinal stromal tumour, calcified

• Spindle cells with loose fascicular-reticular pattern

• Eosinophilic cytoplasm with fibrillary processes 

• Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity 

• Prominent dystrophic calcification

• IHC: CD117, DOG1

• DNA-seq: PDGFRA exon 12 mutation (c.1682T>A; p.Val561Asp)

Gastrointestinal stromal tumourlet, (minute gastric sclerosing stromal tumour)

• Nodular; spindle cell fascicles

• Eosinophilic cytoplasm

• Ovoid and elongated nuclei with minimal pleomorphism; inconspicuous mitotic activity 

• Prominent collagenous stroma with dystrophic calcification

• IHC: CD117, DOG1

• DNA-seq: CKIT exon 11 mutation (c.1662T_1667delAGTACA; p.Val555_Gln556del)

• PMID: 17197927